Top » Catalog » I1 » A399

$18.00

A399
[A399]

A399
hg38 Position: ChrY:12116971..12116971
Ancestral: C
Derived: A
Reference: John M. Rhodes (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A399_F AAAACTGCACAAAGCCTTCAG
Reverse Primer: A399_R CCAATGCACTCCTACCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies