Top » Catalog » I1 » A400

$18.00

A400
[A400]

A400
hg38 Position: ChrY:12464987..12464987
Ancestral: C
Derived: A
Reference: John M. Rhodes (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A400_F CGTATTGAAGGGACTTTACACATTAC
Reverse Primer: A400_R AGAAAATGGGAGGCAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies