Top » Catalog » I1 » A402

$18.00

A402
[A402]

A402
hg38 Position: ChrY:14082169..14082169
Ancestral: G
Derived: A
Reference: John M. Rhodes (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A402_F GATTACAGGTGTGCACCATCAC
Reverse Primer: A402_R CACTGCATTAGCACAGCGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies