Top » Catalog » I1 » A403

$18.00

A403
[A403]

A403
hg38 Position: ChrY:14250768..14250768
Ancestral: C
Derived: T
Reference: John M. Rhodes (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A403_F GGGCTGACCTCAAACTTTTAC
Reverse Primer: A403_R CATGTGATTTGGGCTAAGAGAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies