Top » Catalog » I1 » A404

$18.00

A404
[A404]

A404
hg38 Position: ChrY:14502056..14502056
Ancestral: T
Derived: G
Reference: John M. Rhodes (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A404_F GGAAGGCACACAGATCCATG
Reverse Primer: A404_R ACAGAAATCAATGATTCTAGGACTTGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies