Top » Catalog » I1 » A405

$18.00

A405
[A405]

A405
hg38 Position: ChrY:17221658..17221658
Ancestral: T
Derived: C
Reference: John M. Rhodes (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A405_F CTCGGCTCACTGTAAGCTCTATC
Reverse Primer: A405_R CCTTTGTGCTATTTTCTTTGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies