Top » Catalog » I1 » A5923

$18.00

A5923
[A5923]

A5923
hg38 Position: ChrY:17264437..17264437
Ancestral: G
Derived: T
Reference: Peter Walkerley (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Same position as L1140 but different derived base.
Forward Primer: A5923_F GAAATCATCATTCTCAGCAAACTATG
Reverse Primer: A5923_R TCAAACAGATGTTGGTCATGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies