Top » Catalog » I1 » A1471

$18.00

A1471
[A1471]

A1471
hg38 Position: ChrY:8144944..8144944
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A1471_F TTTCAGAATAAAATTATACATGTAATGCA
Reverse Primer: A1471_R TATTTTCCACTATTTAAAGTAGGAACACC
Reviews

Customers who bought this product also purchased
Y7396
Y7396
A5924
A5924
Y7398
Y7398
Y7397
Y7397
A6159
A6159
A6149
A6149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies