Top » Catalog » I1 » A1471

$18.00

A1471
[A1471]

A1471
hg38 Position: ChrY:8144944..8144944
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A1471_F TTTCAGAATAAAATTATACATGTAATGCA
Reverse Primer: A1471_R TATTTTCCACTATTTAAAGTAGGAACACC
Reviews

Customers who bought this product also purchased
Z62
Z62
I1-Z140 Panel
I1-Z140 Panel
BY477
BY477
Z58
Z58
Z141
Z141
A1603
A1603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY8389
1 x A18555
1 x CTS8995
1 x Y16958
1 x BY7510
1 x A10248
$108.00
Haplogroup Info
Other products
Currencies