Top » Catalog » I1 » A1471

$18.00

A1471
[A1471]

A1471
hg38 Position: ChrY:8144944..8144944
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A1471_F TTTCAGAATAAAATTATACATGTAATGCA
Reverse Primer: A1471_R TATTTTCCACTATTTAAAGTAGGAACACC
Reviews

Customers who bought this product also purchased
I1 Superclade Panel
I1 Superclade Panel
Z2539
Z2539
A196
A196
Z2041
Z2041
F2642
F2642
FT2885
FT2885
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies