Top » Catalog » I1 » A1471

$18.00

A1471
[A1471]

A1471
hg38 Position: ChrY:8144944..8144944
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A1471_F TTTCAGAATAAAATTATACATGTAATGCA
Reverse Primer: A1471_R TATTTTCCACTATTTAAAGTAGGAACACC
Reviews

Customers who bought this product also purchased
BY477
BY477
Z58
Z58
Z141
Z141
A1603
A1603
I1 Superclade Panel
I1 Superclade Panel
Z2539
Z2539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies