Top » Catalog » I1 » A266

$18.00

A266
[A266]

A266
hg38 Position: ChrY:2895519..2895519
Ancestral: C
Derived: N
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2b1 (no listed)
Comments: Found in a I1-Z2541 (ESc13) person
Forward Primer: A266_F GCTTCATGTGAATGAGCCATGT
Reverse Primer: A266_R CCAGACTGGAGTGCAGTAGTTC
Reviews

Customers who bought this product also purchased
S4813
S4813
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies