Top » Catalog » I1 » A269

$18.00

A269
[A269]

A269
hg38 Position: ChrY:12845745..12845745
Ancestral: C
Derived: T
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2b1 (no listed)
Comments: Found in a I1-Z2541 (ESc13) person
Forward Primer: A269_F ACAAGCCACGTAAGGGAATG
Reverse Primer: A269_R GCTGGGAATAGTGGCTTACAC
Reviews

Customers who bought this product also purchased
A272
A272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies