Top » Catalog » I1 » A270

$18.00

A270
[A270]

A270
hg38 Position: ChrY:13298836..13298836
Ancestral: T
Derived: N
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2b1 (no listed)
Comments: Found in a I1-Z2541 (ESc13) person
Forward Primer: A270_F TCTTGGATTGCCATTTTTGAG
Reverse Primer: A270_R AAAACACCTTTCAACCTGATTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies