Top » Catalog » I1 » A271

$18.00

A271
[A271]

A271
hg38 Position: ChrY:15061336..15061336
Ancestral: C
Derived: N
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2b1 (no listed)
Comments: Found in a I1-Z2541 (ESc13) person
Forward Primer: A271_F AGGTGGTCCACACATTCACTC
Reverse Primer: A271_R TTCCTAGCAGAGCACTCAATATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies