Top » Catalog » I1 » A272

$18.00

A272
[A272]

A272
hg38 Position: ChrY:19337949..19337949
Ancestral: G
Derived: C
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2b1 (no listed)
Comments: Found in a I1-Z2541 (ESc13) person
Forward Primer: A272_F CCCCAAAGTCTCAAAAGTCC
Reverse Primer: A272_R CAGAAAGTAAAAAGTGGATGGAGAC
Reviews

Customers who bought this product also purchased
A269
A269
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies