Top » Catalog » I1 » A261

$18.00

A261
[A261]

A261
hg38 Position: ChrY:7818228..7818228
Ancestral: A
Derived: N
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream L338+ AS1H
Forward Primer: A261_F GTGCTGGGATCTGCAATATG
Reverse Primer: A261_R TGTCACCCTCCAATACAAGG
Reviews

Customers who bought this product also purchased
S2000
S2000
A681
A681
I1-L338 Hamilton Group Panel
I1-L338 Hamilton Group Panel
A376
A376
A264
A264
A262
A262
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies