Top » Catalog » I1 » A264

$18.00

A264
[A264]

A264
hg38 Position: ChrY:13730474..13730474
Ancestral: G
Derived: A
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream L338+ AS1H
Forward Primer: A264_F TCTCAAACCTGGAGGCATTC
Reverse Primer: A264_R TGCCACAAAGATGTCAAAGC
Reviews

Customers who bought this product also purchased
A376
A376
I1-L338 Hamilton Group Panel
I1-L338 Hamilton Group Panel
S2000
S2000
A681
A681
A262
A262
A261
A261
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies