Top » Catalog » I1 » A282

$18.00

A282
[A282]

A282
hg38 Position: ChrY:13976069..13976069
Ancestral: C
Derived: N
Reference: T. Popish (2014)
ISOGG Haplogroup: I1a2a2 (not listed)
Comments: Found in a I1-L1451 person
Forward Primer: A282_F TCAGGTAAAAGGGCATTTGG
Reverse Primer: A282_R AGTGGGAGATGGCTTGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies