Top » Catalog » I1 » A285

$18.00

A285
[A285]

A285
hg38 Position: ChrY:20899143..20899143
Ancestral: G
Derived: A
Reference: T. Popish (2014)
ISOGG Haplogroup: I1a2a2 (not listed)
Comments: Below Z2040. equiv. to Y3560
Forward Primer: A285v2_F CTCAGCTTAGCAGCTGAAGAATC
Reverse Primer: A285v2_R GGAGGCTTTGGTTTGGCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies