Top » Catalog » I1 » A196

$18.00

A196
[A196]

A196
hg38 Position: ChrY:15141469..15141469
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I1a2a1a3
Comments: Downstream I1-Z140
Forward Primer: A196_F TCAGGGATTTTTAGCCAACAG
Reverse Primer: A196_R TAGTGATCCCATTGGGGTTG
Reviews

Customers who bought this product also purchased
YFC156739
YFC156739
I1 Superclade Panel
I1 Superclade Panel
CTS6364
CTS6364
S2320
S2320
Z140
Z140
DF29
DF29
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies