Top » Catalog » I1 » A196

$18.00

A196
[A196]

A196
hg38 Position: ChrY:15141469..15141469
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I1a2a1a3
Comments: Downstream I1-Z140
Forward Primer: A196_F TCAGGGATTTTTAGCCAACAG
Reverse Primer: A196_R TAGTGATCCCATTGGGGTTG
Reviews

Customers who bought this product also purchased
Z62
Z62
S2169
S2169
CTS6772
CTS6772
Y3649
Y3649
BY453
BY453
Y1884
Y1884
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies