Top » Catalog » I1 » A376

$18.00

A376
[A376]

A376
hg38 Position: ChrY:19411901..19411901
Ancestral: G
Derived: T
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1~
Comments: Downstream L338+ AS1H
Forward Primer: A376_F GAGAGACACACCAGCACAGC
Reverse Primer: A376_R GTCATCAGTTAAGTCAGGGCAAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A375
A375
I1 Superclade Panel
I1 Superclade Panel
Z2539
Z2539
Z140
Z140
S244
S244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies