Top » Catalog » I1 » A376

$18.00

A376
[A376]

A376
hg38 Position: ChrY:19411901..19411901
Ancestral: G
Derived: T
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1~
Comments: Downstream L338+ AS1H
Forward Primer: A376_F GAGAGACACACCAGCACAGC
Reverse Primer: A376_R GTCATCAGTTAAGTCAGGGCAAG
Reviews

Customers who bought this product also purchased
S244
S244
A8597
A8597
CTS6364
CTS6364
A8601
A8601
DNA Sample Kit
DNA Sample Kit
A375
A375
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies