Top » Catalog » I1 » A5992

$18.00

A5992
[A5992]

A5992
hg38 Position: ChrY:20963785..20963785
Ancestral: G
Derived: A
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140+ F2642+ Y1966+ CTS6772+ [03] Branch
Forward Primer: A5992_F CGCAGACCCTAACACTAGCC
Reverse Primer: A5992_R TTTTATTTCTTCTTGATCTATGAAGCTC
Reviews

Customers who bought this product also purchased
A2053
A2053
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies