Top » Catalog » I1 » A378

$18.00

A378
[A378]

A378
hg38 Position: ChrY:7419388..7419388
Ancestral: T
Derived: G
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: .
Forward Primer: A378_F GGGAGCCTGTTTATAGTTAATATCATTG
Reverse Primer: A378_R ATTTATGACATGATAATCTACATTTTAGTAAATC
Reviews (1)

Customers who bought this product also purchased
A827
A827
A825
A825
A756
A756
A755
A755
A380
A380
A379
A379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies