Top » Catalog » I1 » A379

$18.00

A379
[A379]

A379
hg38 Position: ChrY:8317105..8317105
Ancestral: T
Derived: A
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: .
Forward Primer: A379_F GCTGAATATAGCATATAGGTAATGTGG
Reverse Primer: A379_R CTGGCTAGGAGAGTCAAAATATCTTCT
Reviews (1)

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A754
A754
A383
A383
A381
A381
A380
A380
A378
A378
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2057
1 x A7344
1 x A1550
1 x A7440
1 x A9742
1 x A2410
1 x A1533
$126.00
Haplogroup Info
Other products
Currencies