Top » Catalog » I1 » A380

$18.00

A380
[A380]

A380
hg38 Position: ChrY:8794582..8794582
Ancestral: G
Derived: T
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Below L338
Forward Primer: A380_F CATACACAATTTTATCTATGGTAAAATGC
Reverse Primer: A380_R CTTAACTAAGTTCATGGATAAGTAACTACGT
Reviews (1)

Customers who bought this product also purchased
A754
A754
A383
A383
A381
A381
A379
A379
A378
A378
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies