Top » Catalog » I1 » A381

$18.00

A381
[A381]

A381
hg38 Position: ChrY:11117828..11117828
Ancestral: G
Derived: A
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: .
Forward Primer: A381v2_F GACTCTCCCCTAGCCCCAC
Reverse Primer: A381v2_R CTGAACAACACAGCAAGTTTCTG
Reviews (1)

Customers who bought this product also purchased
A755
A755
A827
A827
A825
A825
A756
A756
A754
A754
A383
A383
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies