Top » Catalog » I1 » A383

$18.00

A383
[A383]

A383
hg38 Position: ChrY:13039648..13039648
Ancestral: A
Derived: G
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: .
Forward Primer: A383_F AGAAAACACAGGAGAAAATAAGTTATGAC
Reverse Primer: A383_R TGATAACAGCTATCCCAAAAGG
Reviews (1)

Customers who bought this product also purchased
A754
A754
A378
A378
A381
A381
A380
A380
A379
A379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies