Top » Catalog » I1 » A7627

$18.00

A7627
[A7627]

A7627
hg38 Position: ChrY:12021071..12021071
Ancestral: G
Derived: A
Reference: Charles Thornton (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508
Forward Primer: A7627_F CATTTACTTGACCTGCAACATCA
Reverse Primer: A7627_R GGTATAGTAGGATAATACAGCGCCTC
Reviews

Customers who bought this product also purchased
FGC23549
FGC23549
FGC43220
FGC43220
FGC23559
FGC23559
Y34377
Y34377
FGC23548
FGC23548
FGC22115
FGC22115
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies