Top » Catalog » I1 » A5521

$18.00

A5521
[A5521]

A5521
hg38 Position: ChrY:21242817..21242817
Ancestral: A
Derived: C
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141 Y6231+ Y9232+ Y6233+ [18] Branch
Forward Primer: A5521_F ACACAGGTACCCAAATGTGC
Reverse Primer: A5521_R TGCCCTAGTCACACCACAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies