Top » Catalog » I1 » A8229

$18.00

A8229
[A8229]

A8229
hg38 Position: ChrY:13701434..13701434
Ancestral: C
Derived: T
Reference: Paul Stone (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Downstream S2078 > S2077 > S2097 > FGC29241
Forward Primer: A8229_F CTCTTTTCTTTTAAGCAGGTCACC
Reverse Primer: A8229_R TGCCATCTGGTTCCCTAGG
Reviews

Customers who bought this product also purchased
L1237
L1237
P38
P38
Z63
Z63
Y2245.2
Y2245.2
M89
M89
Z58
Z58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies