Top » Catalog » I1 » A480

$18.00

A480
[A480]

A480
hg38 Position: ChrY:7679853..7679853
Ancestral: G
Derived: A
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A480_F TGGGGTTCACAATGTACTGG
Reverse Primer: A480_R GTCAGGGGTAGGGTGTTGTG
Reviews

Customers who bought this product also purchased
A484
A484
A483
A483
A490
A490
A489
A489
A488
A488
A486
A486
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies