Top » Catalog » I1 » A480

$18.00

A480
[A480]

A480
hg38 Position: ChrY:7679853..7679853
Ancestral: G
Derived: A
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A480_F TGGGGTTCACAATGTACTGG
Reverse Primer: A480_R GTCAGGGGTAGGGTGTTGTG
Reviews

Customers who bought this product also purchased
Z59
Z59
L1450
L1450
M9
M9
Z58
Z58
Z382
Z382
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies