Top » Catalog » I1 » A1480

$18.00

A1480
[A1480]

A1480
hg38 Position: ChrY:14846178..14846178
Ancestral: G
Derived: N
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A1480_F TGTCATCTTCAGGCATTCAAAG
Reverse Primer: A1480_R AGACCTGGCTTAGGGGTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies