Top » Catalog » I1 » A1486

$18.00

A1486
[A1486]

A1486
hg38 Position: ChrY:21620751..21620751
Ancestral: G
Derived: N
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A1486_F CCACCCTGAGTACAAGTGGC
Reverse Primer: A1486_R ACCTATGATGTCCCACAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies