Top » Catalog » I1 » A1485

$18.00

A1485
[A1485]

A1485
hg38 Position: ChrY:21314149..21314149
Ancestral: T
Derived: N
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A1485_F AGGTGTGAGCCACCATGC
Reverse Primer: A1485_R AGAGGACCTCCACTTCTTGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies