Top » Catalog » I1 » A481

$18.00

A481
[A481]

A481
hg38 Position: ChrY:8639709..8639709
Ancestral: T
Derived: N
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A481_F ATGGAGAACGATCCTCATGG
Reverse Primer: A481_R CTCCTGCAAAGTGCACACAC
Reviews

Customers who bought this product also purchased
A491
A491
A485
A485
A490
A490
A489
A489
A488
A488
A487
A487
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies