Top » Catalog » I1 » A482

$18.00

A482
[A482]

A482
hg38 Position: ChrY:8747947..8747947
Ancestral: A
Derived: G
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1a (not listed)
Comments: Below Z2041 > A480
Forward Primer: A482_F TTGCAGGTCCTTTTTGATCC
Reverse Primer: A482_R GCACTTTCCATTGTCTGTGG
Reviews

Customers who bought this product also purchased
A484
A484
A483
A483
A481
A481
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies