Top » Catalog » I1 » A483

$18.00

A483
[A483]

A483
hg38 Position: ChrY:11876273..11876273
Ancestral: A
Derived: G
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A483_F TTGTGGAGGGTCCCCTTG
Reverse Primer: A483_R CTAATTCTCTGGCAGTCCAATG
Reviews

Customers who bought this product also purchased
A485
A485
A491
A491
A480
A480
A490
A490
A489
A489
A488
A488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies