Top » Catalog » I1 » A484

$18.00

A484
[A484]

A484
hg38 Position: ChrY:12215219..12215219
Ancestral: G
Derived: C
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A484_F TGTCAGCCCTATCCGATACAC
Reverse Primer: A484_R GCACACGGGAAGAACAGC
Reviews

Customers who bought this product also purchased
A480
A480
A487
A487
A486
A486
A491
A491
A485
A485
A490
A490
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies