Top » Catalog » I1 » A486

$18.00

A486
[A486]

A486
hg38 Position: ChrY:12640996..12640996
Ancestral: A
Derived: N
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A486_F CTGCTGAAACCAGCAAACTG
Reverse Primer: A486_R AAAATGATAGAGACACTTGGGTTG
Reviews

Customers who bought this product also purchased
A487
A487
A484
A484
A481
A481
A489
A489
A488
A488
A485
A485
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies