Top » Catalog » I1 » A1597

$18.00

A1597
[A1597]

A1597
hg38 Position: ChrY:14365865..14365865
Ancestral: C
Derived: T
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1597_F CAAATTCATGAGGATTGCTGAC
Reverse Primer: A1597_R TCCTTCACAGAGGAACACCTG
Reviews

Customers who bought this product also purchased
A1599
A1599
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1524
$18.00
Haplogroup Info
Other products
Currencies