Top » Catalog » I1 » A1599

$18.00

A1599
[A1599]

A1599
hg38 Position: ChrY:20441985..20441985
Ancestral: C
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1599_F TGCTGCTATGGACACAGGAC
Reverse Primer: A1599_R CCAGGGATGACTGACAAATG
Reviews

Customers who bought this product also purchased
A1597
A1597
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies