Top » Catalog » I1 » A6809

$18.00

A6809
[A6809]

A6809
hg38 Position: ChrY:22289882..22289882
Ancestral: C
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2b
Comments: Downstream Z138 > Z2541 > S20030
Forward Primer: A6809_F AATCTGGTTAATTTCTAATCCCTTCTC
Reverse Primer: A6809_R ATTAAAAAACAAAACTTTAGCCAGTACC
Reviews

Customers who bought this product also purchased
I1 Superclade Panel
I1 Superclade Panel
S2293
S2293
S21320
S21320
Z2041
Z2041
S19185
S19185
Z140
Z140
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies