Top » Catalog » I1 » A1604

$18.00

A1604
[A1604]

A1604
hg38 Position: ChrY:10013557..10013557
Ancestral: G
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1604_F CAGCAGTCCTCTGATTCCTTC
Reverse Primer: A1604_R CAATGAGTCTTTCCATGGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies