Top » Catalog » I1 » A1606

$18.00

A1606
[A1606]

A1606
hg38 Position: ChrY:21249666..21249666
Ancestral: A
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1606_F CATGCCTGGCTAAGTTTTTG
Reverse Primer: A1606_R CAAGGTTAGAGAAAAGAAAAGGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies