Top » Catalog » I1 » A1609

$18.00

A1609
[A1609]

A1609
hg38 Position: ChrY:12517880..12517880
Ancestral: C
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1609_F GGTCCAGGTAGCAATGAATCC
Reverse Primer: A1609_R ACAATATTTGGTGAAACCCACC
Reviews

Customers who bought this product also purchased
A1614
A1614
A10700
A10700
A1613
A1613
I1-A1605 Crawford Core Segregation Panel
I1-A1605 Crawford Core Segregation Panel
A1612
A1612
A1602
A1602
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies