Top » Catalog » I1 » A1393

$18.00

A1393
[A1393]

A1393
hg38 Position: ChrY:7118663..7118663
Ancestral: C
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: I1-Z140+ [05] Z140 Z141+ A196/Y5497+
Forward Primer: A1393_F TCTTTGCAATGGTGGACAAG
Reverse Primer: A1393_R CCAGACACAGAGGAAGTGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies