Top » Catalog » I1 » A9902

$18.00

A9902
[A9902]

A9902
hg38 Position: ChrY:17221988..17221988
Ancestral: C
Derived: A
Reference: Erik Holmlund (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A9902vl_F CTCGGCTCACTGTAAGCTCTATC
Reverse Primer: A9902vl_R CTTCCAGAATTGCAAGACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A8566
1 x A8728
1 x A10259
$54.00
Haplogroup Info
Other products
Currencies