Top » Catalog » I1 » A5575

$18.00

A5575
[A5575]

A5575
hg38 Position: ChrY:15775838..15775838
Ancestral: T
Derived: C
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1a
Comments: L22+ L205+ Branch
Forward Primer: A5575_F TCCACACTGTGGTTCTCCC
Reverse Primer: A5575_R TGTAGGATCTGGAGCCAGACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies