Top » Catalog » I1 » A9687

$18.00

A9687
[A9687]

A9687
hg38 Position: ChrY:15562356..15562356
Ancestral: G
Derived: A
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-A8100+ Z17925+ Z17928+
Forward Primer: A9687_F GAACTTTTGAACAAGAGGACAACC
Reverse Primer: A9687_R AGAATTTGGCCACCCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies